Al035425
WebAL035425.3 ACTB LAMP2 ZDHHC14 KDM3A TCEAL8 OSBPL8 TIGD5 SPEN AL035425.2 PATL1 PPT1 SQLE NYNRIN CERK RNF157 RENBP ATP11C BAD AC010323.1 GLOD4 … Webbkt41 tattgtaatatgttcccaaggagatg aatctcttatccagaatatactatgtc rp6-24a23 al035425.13 10808-11758 951 — bkt42 aaggcttccaatgaagcaggatggc ggtggtctcaatctagttgaacagc 80010-81026 1017 — bkt43 gtattgcttctagttcagttctatgg tctcctagactcatacatgctaacc 102899-103682 784 — bkt44 gctccctgcgtggcataactctgg atggcagtccaactagttagcgagg 131239-131998 760 — ...
Al035425
Did you know?
WebJul 1, 2024 · AL035425.3: 0.025: 7.41E-01: Subsequently, starBase was also utilized to predict upstream pseudogenes of hsa-miR-30d-5p and 51 pseudogenes were finally obtained as vividly shown in Fig. 6 F. Identically, expression correlation for the 51 pseudogene-hsa-miR-30d-5p pairs in pancreatic cancer were evaluated using TCGA … WebSep 1, 2024 · 1. Introduction. Thyroid cancer (TC) is the commonest malignant tumor in the endocrine system [12].It was estimated that there were about 52,890 new TC cases and 2180 TC-related deaths in the United States in 2024 [27].Despite the relatively favorable prognosis for most TC, a part of TC develops into an aggressive or advanced refractory …
WebJun 13, 2024 · AL035425.2: −4.867341747: C20orf141: 2.010402307: TMPRSS11E: −4.867341747: HEPACAM2: −2.731391743: Go to: Abstract. Background. Although the mortality rates of clear cell renal cell carcinoma (ccRCC) have decreased in recent years, the clinical outcome remains highly dependent on the individual patient. Therefore, … WebShowing subcellular location of AL035425.2 . We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. More …
WebAL035425.2: insulin receptor substrate 4: Homo sapiens: insulin receptor substrate 4 (description) ENSMUSG00000055980: Irs1: insulin receptor substrate 1: Mus musculus: insulin receptor substrate 1 (description) ENSMUSG00000038894: Irs2: insulin receptor substrate 2: Mus musculus: insulin receptor substrate 2 (description) … WebApr 12, 2024 · 1h 10m. Monday. 20-Mar-2024. 08:05PM EDT Detroit Metro Wayne Co - DTW. 08:15PM CDT Dane Co Rgnl - MSN. B712. 1h 10m. Join FlightAware View more …
WebJan 14, 2024 · Human Gene AL035425.2 (ENST00000563887.1) Description and Page Index Description:Homo sapiens insulin receptor substrate 4 (IRS4), transcript variant 2, …
WebJun 13, 2024 · Based on the network organization, we found that miR-107 competed with 16 mRNAs and 4 lncRNAs (LINC02434, AL589642.1, AC003092.1, and AL035425.3) in the module (Figure 3(b)).A previous study showed that miR-107 is upregulated in response to low-oxygen conditions [].Subsequently, miR-107 was found to be abnormally expressed … hatchet house mineral wellsWebThese are internal identifiers that are unique to a mutation on a particular transcript and are displayed in the URL of the mutation pages. Therefore, several of these internal ids … hatchet house of bemidjiWebApr 11, 2024 · A321. 3h 44m. Friday. 31-Mar-2024. 04:59PM CDT Dallas-Fort Worth Intl - DFW. 06:52PM PDT Sacramento Intl - SMF. A321. 3h 53m. Join FlightAware View more … boo thing lyricsWebSep 23, 2024 · The present study identified two key lncRNAs that may potentially have a role in the pathogenesis of psoriasis: AL035425.3 and Prader Willi/Angelman region … hatchet house near meWebConstruction of a lncRNAmiRNAmRNA network to determine the regulatory roles of lncRNAs in psoriasis Buy Article: $42.00 + tax (Refund Policy) hatchet house slidell laWebof psoriasis: AL035425.3 and Prader Willi/Angelman region RNA 6. This integrative analysis enhances the understanding of the molecular mechanism of psoriasis and may provide novel therapeutic targets for the treatment of psoriasis. Introduction Psoriasis is a chronic, systemic, recurrent inflammatory disease, hatchethousethrowing.comWebPsoriasis is a chronic inflammatory skin disorder that impairs the quality of life of affected patients. Emerging studies indicate that certain long non-coding RNAs (lncRNAs) have … boothingsnft